14q(II-27)
	snoid : SR0000126
	Length : 69
	Abstract : Homo sapiens C/D box snoRNA 14q(II-27). The cluster of the 31 highly related 14q(II) snoRNAs was discovered by a genomic analysis of the imprinted human 14q32 locus. Members of this cluster, as well as the snoRNA 14q(0) and the 9 members of the 14q(I) snoRNA cluster, are encoded in introns of the non-coding MEG8 RNA gene. Although near from the maternally expressed GTL2/MEG3 gene, the MEG8 gene is not submitted to genomic imprinting. In the human, 14q(II) is highly expressed in the brain and uterus, and to a lesser extent in the heart. Due to cross-hybridisation in Northern blot analysis, it could not be assessed if all predicted snoRNAs in this cluster are indeed expressed. These snoRNAs are not predicted to guide to 2'O-methylation of a rRNA or snRNA.
	GenBank accession number : NR_003220.1
	Host gene : MEG8 non-coding RNA gene
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Cavaille, J., Seitz, H., Paulsen, M., Ferguson-Smith, A. C., and Bachellerie, J. P. (2002). Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the Prader-Willi/Angelman syndrome region. Hum Mol Genet, 11, 1527-1538.
	Sequence : >14q(II-27) TGGTTCAGTGTTGACTACTGGTGTCGTGTGAGTCATACAATGAATACATGTCTGGAACTCTGAGGCCCA
snoRNABase - http://www-snorna.biotoul.fr/