ACA1
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA1 small nucleolar RNA, H/ACA box 1
	snoid : SR0000068
	Length : 130
	Abstract : Homo sapiens ACA1 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of U4441 in 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997). ACA1, ACA8, ACA18, ACA25, ACA32 and ACA40 and the C/D box snoRNAs mgh28S-2409 and mgh28S-2411 share the same host gene (MGC5306).
	GenBank accession number :
	Host gene : AK128061 (hypothetical protein FLJ46181, 126aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4441
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA1 TGCCTCATTCTAGAGAATGGGCACTGTTGATCATGGTGTCCAAAAATAGTTAATGTGGCTAAATTGAGACAGGTTATGCTTCCATCACAGTATGCATATTGCAGTGGTGACAATGAGACCTGTAACATTT
snoRNABase - http://www-snorna.biotoul.fr/