ACA10
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA10 small nucleolar RNA, H/ACA box 10
	snoid : SR0000216
	Length : 133
	Abstract : Homo sapiens ACA10 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U4491 of 28S rRNA and of residue U210 of 18S rRNA. The pseudouridylation of 28S U4491 was previously reported by Ofengand and Bakin (1997). The pseudouridylation of U210 in 18S rRNA was experimentally confirmed by primer extension mapping by Kiss et al. (2004). ACA10 and U64 share the same host gene. In the mouse RPS2 gene, the ACA10 sequence is interrupted by a B1 element (marked by // in the Alignment file). ACA10 could not be localized in rat and opossum RPS2 genes.
	GenBank accession number : AJ609432
	Host gene : RPS2 (ribosomal protein S2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U210 and 28S rRNA U4491
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA10 GGTCTCTCAGCTCCGCTTAACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAGGCAGAGAAAGGCTCTCCTAATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCTAGGAGTGCGACAATT
snoRNABase - http://www-snorna.biotoul.fr/