ACA13
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA13 small nucleolar RNA, H/ACA box 13
	snoid : SR0000325
	Length : 133
	Abstract : Homo sapiens ACA13 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U1248 of 18S rRNA. The pseudouridylation of this residue was previously reported by Maden and Wakeman (1988).
	GenBank accession number : AJ609455
	Host gene : TIGA1 (hypothetical protein, 120aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1248
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA13 AGCCTTTGTGTTGCCCATTCACTTTGGAAACTAGTGAATGTGGTGTCAAAAAAGGCGTAAATTAAACGCTTTGCAGCCTTTTCCTGCCCTTAAATTTGATACCTTTGGTGTAGGAGCTGCATAAGTAACAGTT
snoRNABase - http://www-snorna.biotoul.fr/