ACA16
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA16A small nucleolar RNA, H/ACA box 16A
	snoid : SR0000008
	Length : 134
	Abstract : Homo sapiens ACA16 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It was previously named U98a by Vitali et al. (2003) and submitted to GenBank under Accession AY349598 as an RNA of unknown function. However, ACA16 was predicted to guide the pseudouridylation of residue U4412 of 28S rRNA (Kiss et al., 2004). The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997). ACA16, ACA44, ACA61 and the C/D box snoRNA HBII-420 share the same host gene.
	GenBank accession number : AJ609433
	Host gene : AF277181 (hypothetical protein PNAS-123, 62aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4412
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551. - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA16 TTGGCCCTTATCGAAGCTGCAGCTGCTTCCGCATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTGACGGTCGCCGTTCTGTTTGTTGTAACTGATCTGCAACATTTTGGGAAAATACAGTT
snoRNABase - http://www-snorna.biotoul.fr/