ACA18
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA18 small nucleolar RNA, H/ACA box 18
	snoid : SR0000071
	Length : 132
	Abstract : Homo sapiens ACA18 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It has no identified target RNA. ACA1, ACA8, ACA18, ACA25, ACA32 and ACA40 and the C/D box snoRNAs mgh28S-2409 and mgh28S-2411 share the same host gene (MGC5306).
	GenBank accession number : AJ609471
	Host gene : AK128061 (hypothetical protein FLJ46181, 126aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA18 GTTGAGGTCTATCCCGATGGGGCTTTTCCTGTAGCCTGCACATCGTTGGAAACGCCTCATAGAGTAACTCTGTGGTTTTACTTTACTCACAGGACTATTGTTAGATCTGTGGGAAGGAATTACAAGACAGTT
snoRNABase - http://www-snorna.biotoul.fr/