ACA23
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA23 small nucleolar RNA, H/ACA box 23
	snoid : SR0000048
	Length : 189
	Abstract : Homo sapiens ACA23 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U3737 and U4331 of 28S rRNA. The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997). However, the phylogenic analysis does not support the hypothesis that the 5’ stem of ACA23 guides the pseudouridylation of 28S rRNA U4331. Rather, the genuine guide for this modification is ACA64.
	GenBank accession number : AJ609438
	Host gene : IPO7 (importin 7)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3737 and 28S rRNA U4331
	sno/scaRNAs with same target 28S rRNA U4331 : ACA64
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA23 CATGGCTGCTGTAATGTGTGCATAGGTTTCATCTGTGTCTGGTAGCAGTGTCTGTCTGTGTTTTTCATTCAGATCTTGCTATCCACACAAACATCATGCGGCCAAAGAGTAACTTGGGATCATAGTACTGGTCTAGTGTTGTCTCTGGACACATCTACCACTGGCCAGCCTCCAAATTCCCACACACAG
snoRNABase - http://www-snorna.biotoul.fr/