ACA24
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA24 small nucleolar RNA, H/ACA box 24
	snoid : SR0000319
	Length : 131
	Abstract : Homo sapiens ACA24 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U863 and U609 of 18S rRNA. The pseudouridylation of U863 was previously reported by Maden and Wakeman (1988). The pseudouridylation of U609 was experimentally confirmed by primer extension mapping by Kiss et al. (2004).
	GenBank accession number : AJ609460
	Host gene : Cluster of mRNAs/ESTs (Unigene Hs.535762 ).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U863 and 18S rRNA U609
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA24 CTCCATGTATCTTTGGGACCTGTCAGCCGTGGCAGTCTCCCTTCCTAGCCATGGAAGAGCATATCCTTGTTTATTGGCAAAGCTGTCACCATTTAATTGGTATCAGATTCTGACTTGCACAAGTAACATTC
snoRNABase - http://www-snorna.biotoul.fr/