ACA27
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA27 small nucleolar RNA, H/ACA box 27
	snoid : SR0000084
	Length : 126
	Abstract : Homo sapiens ACA27 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U3694 and U4522 of 28S rRNA. The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997). ACA27 and the C/D box snoRNA U102 share the same host gene.
	GenBank accession number : AJ609439
	Host gene : RPL21 (ribosomal protein L21).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3694 and 28S rRNA U4522
	sno/scaRNAs with same target 28S rRNA U4522 : HBI-6
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA27 TACCCCCTTTTCACTTTGCCAGTTGGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATATCCTTTTAAAACTCAGGCAAACTGGGTGTTTGTCTGTATCCTGTCAGAGGAAACAAAT
snoRNABase - http://www-snorna.biotoul.fr/