ACA29
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA29 small nucleolar RNA, H/ACA box 29
	snoid : SR0000343
	Length : 140
	Abstract : Homo sapiens ACA29 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It has no identified target RNA. ACA20 and ACA29 share the same host gene (TCP1).
	GenBank accession number : AJ609472
	Host gene : TCP1 (T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha)).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA29 TTTCTCATTTGACTACCACATTTTCTCCTAATAATAGATTTTAGTGGCTATGCTTATGGGATAGATTAAACTTGCCATGATCTGAAGAGGGAGGGTTTTTTCATGTCCTCCTCCTATATGAAATGGCTGAACGGATATTA
snoRNABase - http://www-snorna.biotoul.fr/