ACA3
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA3 small nucleolar RNA, H/ACA box 3
	snoid : SR0000046
	Length : 130
	Abstract : Homo sapiens ACA3 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U3899 and U3938 of 28S rRNA. The pseudouridylation of these residues was previously reported by Ofengand and Bakin. ACA3 and ACA3-2 share the same host gene.
	GenBank accession number : AJ609428
	Host gene : RPL27A (ribosomal protein L27a)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3899 and 28S rRNA U3938
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA3 ATCGAGGCTAGAGTCACGCTTGGGTATCGGCTATTGCCTGAGTGTGCTAGAGTCCTCGAAGAGTAACTGCTGACCTTATTCACTGGCTGTGGGCCTTATGGCACAGTCAGTCACCAGGTTAGAGACATGC
snoRNABase - http://www-snorna.biotoul.fr/