ACA31
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA31 small nucleolar RNA, H/ACA box 31
	snoid : SR0000085
	Length : 130
	Abstract : Homo sapiens ACA31 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of U3713 in 28S rRNA and U218 in 18S rRNA. The pseudouridylation of U3713 in 28S was previously reported by Ofengand and Bakin (1997). Maden and Wakeman (1988) could not determine whether U218, U219 or U220 of 18S rRNA was modified. The pseudouridylation of residue U218 was experimentally confirmed by primer extension mapping by Kiss et al. (2004).
	GenBank accession number : AJ609441
	Host gene : TPT1 (Tumor protein, translationally-controlled 1)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U218 and 28S rRNA U3713
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268. - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA31 CTGCATCCACTGATAGACCTTGAACAATTTACTGTTGTTCTTTTGGTTTGCACTAGGATGCAAAAGAAAGAAATCCCTGCGCTTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGGGGAATACATCT
snoRNABase - http://www-snorna.biotoul.fr/