ACA35
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA1 small Cajal body-specific RNA 1
	snoid : SR0000002
	Length : 166
	Abstract : Homo sapiens ACA35 scaRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U89 of the U2 spliceosomal snRNA. The pseudouridylation of this residue was previously reported by Shibata et al. (1975). As other modification guides of RNA polII-transcribed spliceosomal RNAs, ACA35 co-localizes with coilin in Cajal bodies after overexpression in HeLa cells.
	GenBank accession number : AJ609484
	Host gene : PPP1R8 (protein phosphatase 1, regulatory (inhibitor) subunit 8).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U2 snRNA U89
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Shibata, H., Ro-Choi, T. S., Reddy, R., Choi, Y. C., Henning, D., and Busch, H. (1975). The primary nucleotide sequence of nuclear U-2 ribonucleic acid. The 5'-terminal portion of the molecule. J Biol Chem, 250, 3909-3920.
	Sequence : >ACA35 CAGCACTTGATACTAACCGAGCTGTCTATATCCTAGCCTTGTGTCAAAGGCTTGTGATGTGTTGTGATAGCTGGGTTTAAGAAGTGCAATATTAAAACAAAAGCCATGAGTCTTTTAAGCCCAGTGTGTAAAGATACACTCTGAGTTATAACTCAGAGGCACAACT
snoRNABase - http://www-snorna.biotoul.fr/