ACA37
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA37 small nucleolar RNA, H/ACA box 37
	snoid : SR0000258
	Length : 129
	Abstract : Homo sapiens ACA37 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U4643 of 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997). ACA37 is a Type 1 snoRT originating from ACA30, or more likely from an ACA30 paralogue, ACA30b, hosted by the KIAA1797 gene (Weber, 2006). This snoRT is present in human, chimp, orangutan, rhesus and marmoset genomes, but is absent from bushbaby genome.
	GenBank accession number : AJ609444
	Host gene : MBD2 (methyl-CpG binding domain protein 2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4643
	sno/scaRNAs with same target 28S rRNA U4643 : ACA30
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205
	Sequence : >ACA37 TGAGCACTTTCACAGGTCCTCCCTCAGGCTGTGGGGCCAGGATTTGGTAGCTGGTGCTGAGAGAAAACCTTTGTTGGCATCCTTGCCCTGGGACTGTGCCAGTGGCAGCTGTCATTCAATGGGACAATT
snoRNABase - http://www-snorna.biotoul.fr/