ACA40
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA40 small nucleolar RNA, H/ACA box 40
	snoid : SR0000072
	Length : 127
	Abstract : Homo sapiens ACA40 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues 28S rRNA U4546 and 18S rRNA 1174 (Kiss et al., 2004; Schattner et al. 2006). The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997) and Maden (1990). ACA1, ACA8, ACA18, ACA25, ACA32 and ACA40 and the C/D box snoRNAs mgh28S-2409 and mgh28S-2411 share the same host gene (MGC5306).
	GenBank accession number : AJ609445
	Host gene : AK128061 (hypothetical protein FLJ46181, 126aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4546 and 18S rRNA U1174
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268. - Maden, B. E. (1990). The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog Nucleic Acid Res Mol Biol, 39, 241-303. - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25
	Sequence : >ACA40 TGCACTTATGTATGTTTTTGTTTAACGTGGACAAAGACTTACAGATAGGTGCAAAAAATAAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGGATATTA
snoRNABase - http://www-snorna.biotoul.fr/