ACA41
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA41 small nucleolar RNA, H/ACA box 41
	snoid : SR0000279
	Length : 132
	Abstract : Homo sapiens ACA41 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U1643 of 18S rRNA. The pseudouridylation of this residue was previously reported by Maden and Wakeman (1988). The mouse ortholog, MBI-83, was cloned by Huttenhofer et al. 2001). A primate-specific type 2 ACA41 snoRT (also present in marmoset) resides in the C15orf21 gene (sense orientation; chr15:43,616,740-43,616,867; hg18) (Luo and Li, 2007; Weber, unpublished).
	GenBank accession number : AJ609464
	Host gene : EEF1B2 (eukaryotic translation elongation factor 1 beta 2).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1643
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464. - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71.
	Sequence : >ACA41 TTCCACAGCTACTGGTCTGCAGCTGTTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACTGTTAACACAAACACCTCTTTCTTAGCAAAACAGAAAGTGGGTATATATGTGTGACAGACACAA
snoRNABase - http://www-snorna.biotoul.fr/