ACA43
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA43 small nucleolar RNA, H/ACA box 43
	snoid : SR0000365
	Length : 136
	Abstract : Homo sapiens ACA43 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U4938 of 28S rRNA. The pseudouridylation of residue 4937, but not 4938 was reported by Ofengand and Bakin (1997). ACA43 and ACA17 share the same host gene.
	GenBank accession number : AJ609446
	Host gene : Cluster of mRNAs/ESTs (Unigene Hs.549706, hypothetical protein MGC16037, significant homology with human collagen alpha 1).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4938
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA43 GCTGTCCTGGACCTGTTGGCACCACAGACAGTTGCTCTGCTGTGCCTGTGGCCTCGGGGCAAAGAGAAAGTGGCGATTTCTACACTCAGTGCTCGGGAACCAGTGGGCACTGAGAATGGTTTATGGCCTGACATTA
snoRNABase - http://www-snorna.biotoul.fr/