ACA44
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA44 small nucleolar RNA, H/ACA box 44
	snoid : SR0000007
	Length : 132
	Abstract : Homo sapiens ACA44 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U822 and U686 of 18S rRNA. Maden and Wakeman (1988) could not determine whether U822 or U823 was modified. The pseudouridylation of residue U686 was experimentally confirmed by primer extension mapping by Kiss et al. (2004). ACA16, ACA44, ACA61 and the C/D box snoRNA HBII-420 share the same host gene. The mouse ortholog, MBI-64 was cloned by Huttenhofer et al. (2001).
	GenBank accession number : AJ609466
	Host gene : AF277181 (hypothetical protein PNAS-123, 62aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U822 and 18S rRNA U686
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA44 CAGCATGTTTCCAAGGGCTGTGGCTGGTCATAGCCATGGGATCTCCAACTGCATGCAAGAGCAACCTGGAAAGACTTTGACAGCGCAGGTCAGTACAATACCTGCAAGCTGCCACTCAGCTTTCCTATAATG
snoRNABase - http://www-snorna.biotoul.fr/