ACA51
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA51 small nucleolar RNA, H/ACA box 51
	snoid : SR0000286
	Length : 132
	Abstract : Homo sapiens ACA51 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It has no identified target RNA. As the C/D box snoRNA HBII-55, ACA51 snoRNA gene is located in an intron the NOL5A (nucleolar protein 5A) gene. The NOL5A protein is the orthologue of the yeast Nop56p protein, and is a common constituent of the C/D box snoRNPs.
	GenBank accession number : AJ609477
	Host gene : NOL5A (nucleolar protein 5A, or NOP56, a common constituent of C/D box snoRNPs)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA51 GGCCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGTAGAGTAAACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
snoRNABase - http://www-snorna.biotoul.fr/