ACA52
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA52 small nucleolar RNA, H/ACA box 52
	snoid : SR0000044
	Length : 134
	Abstract : Homo sapiens ACA52 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U1731 of 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997).
	GenBank accession number : AJ609448
	Host gene : RPLP2 (ribosomal protein LP2).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U1731
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA52 TGGTCCATCCTAATCCCTGCCGGTCCATCTGTGGCCTGCCAGGTTTCGCTTGTGGACCAGAGCACCCTAGAAGCCTCACCCGAGGAGTGAGCAGGGCTCCAGTGGGCTCACGTCATGGGCACTTCTAGACACTC
snoRNABase - http://www-snorna.biotoul.fr/