ACA56
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA56 small nucleolar RNA, H/ACA box 56
	snoid : SR0000375
	Length : 129
	Abstract : Homo sapiens ACA56 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U1664 of 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997). ACA56 and ACA36 share the same host gene (dyskerin).
	GenBank accession number : AJ609449
	Host gene : DKC1 (dyskeratosis congenita 1, dyskerin)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U1664
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA56 CGGCAGACAGTTATCCCTTTCTAGTCTGGCTCGTGGGACTCTAGAGGGAGTCAGTCTGCAACAGTAAGTGGTGAGTTCTTCTGTCCAGCGTCAGTATTTTGATGGTGGCTTTAGACTTGCCAGATAACA
snoRNABase - http://www-snorna.biotoul.fr/