ACA58
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA58 small nucleolar RNA, H/ACA box 58
	snoid : SR0000309
	Length : 137
	Abstract : Homo sapiens ACA58 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U3823 of 28S rRNA. The pseudouridylation of this residue was previously reported by Ofengand and Bakin (1997).
	GenBank accession number : AJ609450
	Host gene : MRPL3 (mitochondrial ribosomal protein L3)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U3823
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA58 GGGCATACTCGTAGACCTTGCCTGACTGTGCTCATGTCCAGGCAGGGGGGACAGTGTATGCAAGAATAATTTGGAGTTCCTGCCAGCTCTAACCAGCTTCATCAGTGGCTGGATAAATTGCAGGACTCTAAACATTT
snoRNABase - http://www-snorna.biotoul.fr/