ACA5b
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA5B small nucleolar RNA, H/ACA box 5B
	snoid : SR0000348
	Length : 135
	Abstract : Homo sapiens ACA5b snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. As its close paralogues ACA5 and ACA5c, this RNA is predicted to guide the pseudouridylation of residue U1238, and possibly U1625, of 18S rRNA. ACA5, ACA5b and ACA5c share the same host gene (TBRG4).
	GenBank accession number :
	Host gene : TBRG4 (transforming growth factor beta regulator 4, cell cycle progression 2 protein isoform 2, KIAA0948 protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1238
	sno/scaRNAs with same target 18S rRNA U1238 : ACA5   ACA5c
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA5b GGCAGCCATGTCAAATTCAGTGCCTGCCCTGTCTATGGTAGGCACTGGCCCAGAAGACTGCCACAGAAACAGTGACTCACAGGCCCTGTTACTGTGTCCCAGGCTCAGGGATAAATTTGGTTACAGACACCA
snoRNABase - http://www-snorna.biotoul.fr/