ACA60
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA60 small nucleolar RNA, H/ACA box 60
	snoid : SR0000296
	Length : 136
	Abstract : Homo sapiens ACA60 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residues U1004 of 18S rRNA. Maden and Wakeman (1988) could not determine whether U1003 or U1004 was modified. ACA60 and ACA39 share the same host gene.
	GenBank accession number : AJ609469
	Host gene : LOC128439 (hypothetical protein, 108aa).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1004
	sno/scaRNAs with same target 18S rRNA U1004 : U99
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464.
	Sequence : >ACA60 CACCTGCATTCAAAAATGATCACGGGCTGCCTGTGCTCTGGTCATCAATAACGCAGGGAGAGGAATTGCTGAAAGCCGTTTCCCGTGTTTGGAGGGTTCACACCTGTCCCTTTCAAATGCTGGCGCTTTCACACAC
snoRNABase - http://www-snorna.biotoul.fr/