ACA61
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA61 small nucleolar RNA, H/ACA box 61
	snoid : SR0000006
	Length : 130
	Abstract : Homo sapiens ACA61 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U2495 of 28S rRNA. The pseudouridylation of this residue has been experimentally confirmed by primer extension mapping. ACA16, ACA44, ACA61 and the C/D box snoRNA HBII-420 share the same host gene.
	GenBank accession number : AJ609451
	Host gene : AF277181 (hypothetical protein PNAS-123, 62aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U2495
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807
	Sequence : >ACA61 ATCCTCCTGATCCCTTTCCCATCGGATCTGAACACTGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTAATAGTGAAGCTGGCCTAAATGTTGTAATCTGGTATATGGCATGTGGGCTAGTTTCAGACAGGT
snoRNABase - http://www-snorna.biotoul.fr/