ACA9
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA9 small nucleolar RNA, H/ACA box 9
	snoid : SR0000345
	Length : 133
	Abstract : Homo sapiens ACA9 snoRNA This H/ACA box RNA was cloned by Kiss et al. (2004) from a HeLa cell extract immunoprecipitated with an anti-GAR1 antibody. It is predicted to guide the pseudouridylation of residue U1670 and U1769 of 28S rRNA . The pseudouridylation of these residues was previously reported by Ofengand and Bakin (1997).
	GenBank accession number : AJ609431
	Host gene : Cluster of ESTs (UniGene Hs.25892, similar to hepatocyte growth factor-like protein precursor).
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U1670 and 28S rRNA U1769
	References : - Kiss, A. M., Jady, B. E., Bertrand, E., and Kiss, T. (2004). Human box H/ACA pseudouridylation guide RNA machinery. Mol. Cell .Biol. 24, 5797-5807 - Ofengand, J., and Bakin, A. (1997). Mapping to nucleotide resolution of pseudouridine residues in large subunit ribosomal RNAs from representative eukaryotes, prokaryotes, archaebacteria, mitochondria and chloroplasts. J Mol Biol 266, 246-268.
	Sequence : >ACA9 TAGCAAGCCTCCAGCGTGCTTGGGTCTGCGGTGACCCTATGCATTCCTTCAGTGCTTGCTAGAACAGTTTTGAAACGGTTTGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGAAATTTCAGACAATG
snoRNABase - http://www-snorna.biotoul.fr/