HBI-61
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA81 small nucleolar RNA, H/ACA box 81
	snoid : SR0000314
	Length : 178
	Abstract : Homo sapiens HBI-61 snoRNA. This H/ACA box RNA was cloned by Gu et al. (2005) from blood cells by an RT-PCR method that preferentially amplifies H/ACA box snoRNAs. Its expression was evidenced by Northern blot. Its mouse orthologue was cloned by Hüttenhofer et al. (2001) and named MBI-61.HBI-61 is predicted to guide the pseudouridylation of 28S rRNA U4606 (Schattner et al., 2006). The modification of this position was experimentally established (Ofengand and Bakin, 1997). The H/ACA box snoRNAs HBI-61, E3 and ACA4 and the C/D box snoRNA snR39B share the same host gene.
	GenBank accession number : AM055745
	Host gene : EIF4A2 (eukaryotic translation initiation factor 4A, isoform 2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U4606
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25 - Gu, A. D., Zhou, H., Yu, C. H., and Qu, L. H. (2005). A novel experimental approach for systematic identification of box H/ACA snoRNAs from eukaryotes. Nucleic Acids Res 33, e194.
	Sequence : >HBI-61 ACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGACACTAGGACCATGTCTTGGTTTTTGCAATAATGCTAGCAGAGTACACACAAGAAGAAAAGTAACAGCACTAGATTGTAAAGACTGGGGTGGACCTCTTTCTTAATGTCCAATGTCCTTTGTCTTAAGATTTGGTGCAATATCT
snoRNABase - http://www-snorna.biotoul.fr/