HBII-276
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD87 small nucleolar RNA, C/D box 87
	snoid : SR0000354
	Length : 76
	Abstract : Homo sapiens C/D box snoRNA HBII-276. This snoRNA is the human orthologue of the mouse MBII-276 described by Hüttenhofer et al. (2001). HBII-276 is predicted to guide the 2'O-ribose methylation of 28S rRNA G3723. This snoRNA was described by Gogolevskaya et al. (2002) and named U87. It should not be confounded with the U87 scaRNA cloned by Darzacq et al. (2002).
	GenBank accession number :
	Host gene : AY264285, improperly named U87 host gene
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA G3723
	References : - Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. Embo J 21, 2746-2756. - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Gogolevskaya, I. K., Makarova, J. A., Gause, L. N., Kulichkova, V. A., Konstantinova, I. M., and Kramerov, D. A. (2002). U87 RNA, a novel C/D box small nucleolar RNA from mammalian cells. Gene, 292, 199-204.
	Sequence : >HBII-276 ACAATGATGACTTAAATTACTTTTTGCCGTTTACCCAGCTGAGGTTGTCTTTGAAGAAATAATTTTAAGACTGAGA
snoRNABase - http://www-snorna.biotoul.fr/