HBII-419
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD98 small nucleolar RNA, C/D box 98
	snoid : SR0000041
	Length : 67
	Abstract : Homo sapiens C/D box snoRNA HBII-419. This snoRNA is the human orthologue of the mouse MBII-419 described by Hüttenhofer et al. (2001). It is predicted to guide the 2'0-ribose methylation of 18S rRNA G867 (J. Cavaillé, pers. comm..). This methylation site was mapped by Maden (1990).
	GenBank accession number :
	Host gene : CCAR1 (Death inducer with SAP domain DIS)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA G867
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Maden, B. E. (1990). The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog Nucleic Acid Res Mol Biol, 39, 241-303.
	Sequence : >HBII-419 GAGTTATGATGTGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACACAATGAACTGAACTC
snoRNABase - http://www-snorna.biotoul.fr/