HBII-437
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD108 small nucleolar RNA, C/D box 108
	snoid : SR0000134
	Length : 71
	Abstract : Homo sapiens C/D box snoRNA HBII-437. This snoRNA was discovered by computer aided search of conserved sequences and structural motifs in the Prader-Willi locus (15q11-q13). However, its expression could not confirmed by Northern blot analysis. HBII-437 (as well as HBII-438A/B, HBII-13, HBII-436 and the two clusters of HBII-85 and HBII-52 snoRNAs) is encoded in an intron of the large (460kb), paternally expressed, transcription unit (SNURF-SNRNP-UBE3A AS), that is antisense to the maternally expressed UBE3A gene. This snoRNA, which harbors a degenerated D box, has no identified RNA target.
	GenBank accession number : AY055807
	Host gene : SNURF-SNRNP-UBE3A AS
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Runte, M., Huttenhofer, A., Gross, S., Kiefmann, M., Horsthemke, B., and Buiting, K. (2001). The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. Hum Mol Genet, 10, 2687-2700.
	Sequence : >HBII-437 GCTTAATGATGAGAATCATTATTTCTTGAATTGGATGACACTTTCCATTCCTGCAAAGGGAGCGTGAGGTC
snoRNABase - http://www-snorna.biotoul.fr/