HBII-99
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD12 small nucleolar RNA, C/D box 12
	snoid : SR0000298
	Length : 90
	Abstract : Homo sapiens C/D box snoRNA HBII-99. This snoRNA is the human orthologue of the mouse MBII-99 described by Hüttenhofer et al. (2001). It is predicted to guide the 2'O-ribose methylation of 28S rRNA G3878.HBII-99 (SNORD12), U106 (SNORD12C) and the highly related copy SNORD12B (GenBank AM413026, Yang et al., 2006) share the same host gene (C20orf199), and have probably the same RNA target.
	GenBank accession number :
	Host gene : C20orf199 (hypothetical protein, 92aa)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA G3878
	sno/scaRNAs with same target 28S rRNA G3878 : HBII-99B
	References : - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >HBII-99 GCCTTTGCAGCTGATGATACAGCTTCTTTCCCCATCAGATCGACCCTGTTGATCTCTACACTATTGGCCAGTTTTGTCTGATGCATTGGC
snoRNABase - http://www-snorna.biotoul.fr/