SNORA11B  also known as U107E
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA11B small nucleolar RNA, H/ACA box 11B
	snoid : SR0000461
	Length : 131
	Abstract : Human SNORA11B H/ACA box snoRNA. This snoRNA was discovered by Yang et al. (2006) with the snoSeeker software. It was characterized as a primate-specific U106 (SNORA11) Type 1 snoRT (Weber, 2006; Luo and Li, 2007). See entry U107 for alignement (U107e in C14orf159).
	GenBank accession number : AM413016
	Host gene : C14orf159
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Luo Y. and Li S. (2007) Genome-wide analyses of retrogenes derived from the human box H/ACA snoRNAs. Nuc. Acids Res. 35(2):559-71. - Weber MJ. (2006) Mammalian Small Nucleolar RNAs Are Mobile Genetic Elements. PLoS Genet. 2(12):e205 - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >SNORA11B GGGGTGTGCTCAGAGCAGGGGGCCCGAAGAATGCCTCCTCTGTTTACAACACACCCAATAGGAATCTGGGGTCATTGTGACAAGGGACACAGAGCTTGTGACCTCCCTACAAACAAATGCCCTACACAT
snoRNABase - http://www-snorna.biotoul.fr/