SNORA38B  also known as ACA38B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA38B small nucleolar RNA, H/ACA box 38B
	snoid : SR0000466
	Length : 131
	Abstract : Human SNORA38B H/ACA snoRNA. This snoRNA was discovered by Yang et al. (2006) with the snoSeeker software. It resides in the NOL11 gene in chimp, rhesus, orangutan and marmoste genomes, and is probably a primate-specific Type 1 snoRT. A very similar snoRT (extragenic) inserted in a Tigger3 element resides on chr12:117,810,622-117,810,751. A mouse-specific ACA38 Type 1 snoRT resides in the Pawr gene. See ACA38 file for alignment.
	GenBank accession number : AM413013
	Host gene : NOL11 (nucleolar protein 11)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >SNORA38B CCCTCCTACAAAGGCATGTCTATAGTTCCTTGTCTTTGGACATGTAAGAATTGGAGGCAAAGAAATGTGGACTTGGAGAAATCTGGGGCCAGCTTGCTCTCCGCAGGCTCAAGATCAACCATCCCACATAG
snoRNABase - http://www-snorna.biotoul.fr/