SNORD124
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD124 small nucleolar RNA, C/D box 124
	snoid : SR0000487
	Length : 104
	Abstract : Homo sapiens SNORD124 snoRNA. This C/D box snoRNA was discovered by Yang et al. (2006) with snoSeeker, and its expression verified by Northern blot.
	GenBank accession number : AM413036
	Host gene : THRAP4/MED24 (thyroid hormone receptor-associated protein 4/mediator complex subunit 24)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Yang,J.H., Zhang,X.C., Huang,Z.P., Zhou,H., Huang,M.B., Zhang,S.,Chen,Y.Q. and Qu,L.H. (2006) snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. Nuc. Acids Res. 34:5112-5123
	Sequence : >SNORD124 TGGTCTCAAGGAAGGGATGATGTTCCAGTTGAGACTCAAGAAAAGGATTCTGAGCCTCAGAGCTTTGAAGGAGCCACTTGGTCCCTGACCTTCCTAGAGGCAAA
snoRNABase - http://www-snorna.biotoul.fr/