U100
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SCARNA14 small Cajal body-specific RNA 14
	snoid : SR0000210
	Length : 140
	Abstract : Homo sapiens U100 scaRNA. This H/ACA box RNA was originally cloned from a mouse brain library by Huttenhofer et al. (2001) and named MBII-201. Its human ortholog, U100, was characterized by Northern blot and was localized by FISH to Cajal bodies. From base-pairing prediction, it could guide the pseudouridylation of the U6 residue in the U6 spliceosomal snRNA. However, it was verified that this base is not pseudouridylated (Vitalli et al., 2003). Schattner et al. (2006) predicted that U100 guides the pseudouridylation of U2 snRNA U7.
	GenBank accession number : AY349601
	Host gene : FLJ20516 (Timeless-interacting protein)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : U2 snRNA U7
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551. - Huttenhofer, A., Kiefmann, M., Meier-Ewert, S., O'Brien, J., Lehrach, H., Bachellerie, J. P., and Brosius, J. (2001). RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. Embo J 20, 2943-2953. - Schattner, P., Barberan-Soler, S., and Lowe, T. M. (2006). A computational screen for mammalian pseudouridylation guide H/ACA RNAs. Rna 12, 15-25
	Sequence : >U100 GTGACTGTTCCTGGTATTGATTGCATTTGTTAGTTGTACAGTGCAACCATAGACAGTCACACACATTAAAACAGATGGTTCCTGCCGACAGGGTCTGTATAGTTATCAGATTTTCTGTGCGATGGCTCCATACATGT
snoRNABase - http://www-snorna.biotoul.fr/