U101
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD101 small nucleolar RNA, C/D box 101
	snoid : SR0000339
	Length : 73
	Abstract : Homo sapiens C/D box snoRNA U101. This snoRNA was identified by Vitali et al. (2003) in the systematic search for C/D box hallmarks in the introns of ribosomal protein genes. U101 gene resides in intron 3 of the ribosomal protein S12 gene, whereas intron 4 of the same gene hosts the C/D box snoRNA HBII-429, and intron 5 the H/ACA box snoRNA ACA33. U101 has no predicted target RNA.
	GenBank accession number : AY349602
	Host gene : RPS12 (ribosomal protein S12)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U101 GTTTGAATGATGACTTTAATTGTCGGATACCCCTTCACTCCTTTTATGAGTGAAACATAAGAGTCTGACAAAC
snoRNABase - http://www-snorna.biotoul.fr/