U104
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD104 small nucleolar RNA, C/D box 104
	snoid : SR0000248
	Length : 80
	Abstract : Homo sapiens C/D box snoRNA U104. This snoRNA was first cloned from a rat cDNA library, and its human orthologue identified by database search (Vitali et al., 2003). U104 is predicted to guide the 2'O-ribose methylation of C1327 of 28S rRNA. Its rodent orthologues are also known as Z12 snoRNAs.
	GenBank accession number : AY349605
	Host gene : Cluster of spliced ESTs (UniGene Hs.405444)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA C1327
	References : - Vitali, P., Royo, H., Seitz, H., Bachellerie, J. P., Huttenhofer, A., and Cavaille, J. (2003). Identification of 13 novel human modification guide RNAs. Nucleic Acids Res 31, 6543-6551.
	Sequence : >U104 GGCCTGCTGTGATGACATTCCAATTAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTGGAGTCTGAGCCTGCC
snoRNABase - http://www-snorna.biotoul.fr/