U107
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORA11 small nucleolar RNA, H/ACA box 11
	snoid : SR0000368
	Length : 131
	Abstract : Homo sapiens U107 snoRNA. This H/ACA box RNA was cloned by Gu et al. (2005) from blood cells by an RT-PCR method that preferentially amplifies H/ACA box snoRNAs. Its expression was evidenced by Northern blot. Close paralogues reside on chrX in MAGED4 and TRO genes. U107 has no identified RNA target. The presence of a conserved potential Cajal body localization signal (or CAB box, Richard et al., 2003) suggests that U107 might be a scaRNA.
	GenBank accession number : AM055729
	Host gene : MAGED2 (melanoma antigen family D, 2)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Richard, P., Darzacq, X., Bertrand, E., Jady, B. E., Verheggen, C., and Kiss, T. (2003). A common sequence motif determines the Cajal body-specific localization of box H/ACA scaRNAs. Embo J, 22, 4283-4293. - Gu, A. D., Zhou, H., Yu, C. H., and Qu, L. H. (2005). A novel experimental approach for systematic identification of box H/ACA snoRNAs from eukaryotes. Nucleic Acids Res 33, e194.
	Sequence : >U107 GGGGTGTGCTCAGAGCAGGGGGCCCAAAGAATGGCTCCTCTGTTTACAACACACCCAACAGGAATCTGGGGTCATTGTGATGAGGGCGTCAAACTTGTGGCTTCCCTATGAACAAACGTCCCCCAACACCT
snoRNABase - http://www-snorna.biotoul.fr/