U16
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD16 small nucleolar RNA, C/D box 16
	snoid : SR0000213
	Length : 101
	Abstract : Homo sapiens C/D box snoRNA U16. This snoRNA was originally characterized in an intron of the Xenopus laevis and human RPL1 genes by Fragapane et al. (1993). U16 was postulated to guide the 2'O-ribose methylation of 18S rRNA A484 by Kiss-Laszlo et al. (1996). U16 and three related copies of the C/D box snoRNA U18 share the same host gene (ribosomal protein L4, RPL4 or RPL1).
	GenBank accession number :
	Host gene : RPL4 (ribosomal protein L4)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA A484
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Fragapane, P., Prislei, S., Michienzi, A., Caffarelli, E., and Bozzoni, I. (1993). A novel small nucleolar RNA (U16) is encoded inside a ribosomal protein intron and originates by processing of the pre-mRNA. Embo J, 12, 2921-2928.
	Sequence : >U16 TTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCAGTAAGCTGGTACAGAAGGTTGACGAAAATTCTTACTGAGCAA
snoRNABase - http://www-snorna.biotoul.fr/