U21
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD21 small nucleolar RNA, C/D box 21
	snoid : SR0000020
	Length : 95
	Abstract : Homo sapiens C/D box snoRNA U21. This snoRNA was initially characterized by a bioinformatics search for C/D motives in a vertebrate intron database (Qu et al. 1994). U21 was postulated to guide the 2'O-ribose methylation of 28S rRNA G1303 by Kiss-Laszlo et al. (1996), although this 2'O-methylated base was not mapped by Maden (1990). U21 shares the same host gene with the H/ACA box snoRNA U66 (RPL5).
	GenBank accession number :
	Host gene : RPL5 (ribosomal protein L5)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA G1303
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Maden, B. E. (1990). The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog Nucleic Acid Res Mol Biol, 39, 241-303. - Qu, L. H., Nicoloso, M., Michot, B., Azum, M. C., Caizergues-Ferrer, M., Renalier, M. H., and Bachellerie, J. P. (1994). U21, a novel small nucleolar RNA with a 13 nt. complementarity to 28S rRNA, is encoded in an intron of ribosomal protein L5 gene in chicken and mammals. Nucleic Acids Res, 22, 4073-4081.
	Sequence : >U21 GCTGAATGATGATATCCCACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATGATGCGATAATTGTTTCAAGACGGGACTGATGGCAGC
snoRNABase - http://www-snorna.biotoul.fr/