U22
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD22 small nucleolar RNA, C/D box 22
	snoid : SR0000054
	Length : 126
	Abstract : Homo sapiens C/D box snoRNA U22. This snoRNA was originally characterized among RNAs immunoprecipitated with an anti-(U3)RNP monoclonal antibody, and named RNA Y (Tyc and Steitz, 1989). Tycowski, Shu and Steitz (1994) later showed that U22 is required for the processing of 18S rRNA in Xenopus oocytes. U22 shares the same host gene (UHG) with several other C/D box snoRNAs (U25-U31). Exons of this gene are poorly conserved, and have little potential for protein coding (Tycowski, Shu and Steitz, 1996).
	GenBank accession number :
	Host gene : UHG (U22 Host Gene)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : unknown
	References : - Tycowski, K. T., Shu, M. D., and Steitz, J. A. (1996). A mammalian gene with introns instead of exons generating stable RNA products. Nature, 379, 464-466. - Tyc, K., and Steitz, J. A. (1989). U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus. Embo J, 8, 3113-3119. - Tycowski, K. T., Shu, M. D., and Steitz, J. A. (1994). Requirement for intron-encoded U22 small nucleolar RNA in 18S ribosomal RNA maturation. Science, 266, 1558-1561.
	Sequence : >U22 TCCCAATGAAGAAACTTTCACATGTCTTACTCTCTGTCCTAGTCCCAGAGCCTGTAAAGGTGAACCCACTGGGACTGGCTGGGGGAGAAGAGGAAGATTTGTTCCAGAAGGAACTGTCTGAGGGAT
snoRNABase - http://www-snorna.biotoul.fr/