U29
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD29 small nucleolar RNA, C/D box 29
	snoid : SR0000057
	Length : 65
	Abstract : Homo sapiens C/D box snoRNA U29. This snoRNA was initially characterized as a conserved intronic sequence in the U22 host gene, UGH. Other introns of the same gene host the C/D box snoRNAs U26-U31 (Tycowski, Shu and Steitz, 1996). U29 was postulated to guide the 2'O-ribose methylation of 28S rRNA A4493 by Kiss-Laszlo et al. (1996).
	GenBank accession number :
	Host gene : U22 host gene (UHG)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A4493
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Tycowski, K. T., Shu, M. D., and Steitz, J. A. (1996). A mammalian gene with introns instead of exons generating stable RNA products. Nature, 379, 464-466.
	Sequence : >U29 TTTCTATGATGAATCAAACTAGCTCACTATGACCGACAGTGAAAATACATGAACACCTGAGAAAC
snoRNABase - http://www-snorna.biotoul.fr/