U31
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD31 small nucleolar RNA, C/D box 31
	snoid : SR0000055
	Length : 71
	Abstract : Homo sapiens C/D box snoRNA U31. This snoRNA was initially characterized as a conserved intronic sequence in the U22 host gene, UGH. Other introns of the same gene host the C/D box snoRNAs U26-U30 (Tycowski, Shu and Steitz, 1996). U31 was postulated to guide the 2'O-ribose methylation of 28S rRNA G4166 by Kiss-Laszlo et al. (1996), although this methylated base was not mapped by Maden (1990).
	GenBank accession number :
	Host gene : U22 host gene (UHG)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A4166
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Tycowski, K. T., Shu, M. D., and Steitz, J. A. (1996). A mammalian gene with introns instead of exons generating stable RNA products. Nature, 379, 464-466. - Maden, B. E. (1990). The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog Nucleic Acid Res Mol Biol, 39, 241-303.
	Sequence : >U31 CTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGATCAATGTGTGACTGAAAGGTATTTTCTGAGCTGTG
snoRNABase - http://www-snorna.biotoul.fr/