U32A
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD32A small nucleolar RNA, C/D box 32A
	snoid : SR0000264
	Length : 77
	Abstract : Homo sapiens C/D box snoRNA U32A. This snoRNA is the human orthologue of mouse U32 snoRNA, initially characterized by a bioinformatics search for C/D motives in a vertebrate intron database (Nicoloso et al. 1996). It is predicted to guide the 2'O-ribose methylation of both 18S rRNA G1328 and 28S rRNA A1511. U32A share the same host gene with the C/D box snoRNAs U33, U34 and U35A (RPL13A).
	GenBank accession number :
	Host gene : RPL13A (ribosomal protein L13A)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA G1328 and 28S rRNA A1511
	sno/scaRNAs with same target 28S rRNA A1511 : U32B   U51
	References : - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U32A GTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACGGCCATGAGATCAACCCCATGCACCGCTCTGAGA
snoRNABase - http://www-snorna.biotoul.fr/