U33
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD33 small nucleolar RNA, C/D box 33
	snoid : SR0000265
	Length : 83
	Abstract : Homo sapiens C/D box snoRNA U33. This snoRNA is the human orthologue of mouse U33 snoRNA, initially characterized by a bioinformatics search for C/D motives in a vertebrate intron database (Nicoloso et al. 1996). It is predicted to guide the 2'O-ribose methylation of 18S rRNA U1326. Interestingly, this nucleotide is also pseudo-uridinated (Maden and Wakeman, 1988), but the corresponding guide remains unknown. U33 share the same host gene with the C/D box snoRNAs U32A, U34 and U35A (RPL13A).
	GenBank accession number :
	Host gene : RPL13A (ribosomal protein L13A)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA U1326
	References : - Maden, E. H., and Wakeman, J. A. (1988). Pseudouridine distribution in mammalian 18 S ribosomal RNA. A major cluster in the central region of the molecule. Biochem J 249, 459-464. - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U33 GGCCGGTGATGAGAACTTCTCCCACTCACATTCGAGTTTCCCGACCATGAGATGACTCCACATGCACTACCATCTGAGGCCAC
snoRNABase - http://www-snorna.biotoul.fr/