U34
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD34 small nucleolar RNA, C/D box 34
	snoid : SR0000266
	Length : 66
	Abstract : Homo sapiens C/D box snoRNA U34. This snoRNA was initially characterized by a bioinformatics search for C/D motives in a vertebrate intron database (Nicoloso et al., 1996). It is predicted to guide the 2'O-ribose methylation of 28S rRNA U2824. U34 shares the same host gene with the C/D box snoRNAs U32A, U33 and U35A (RPL13A).
	GenBank accession number :
	Host gene : RPL13A (ribosomal protein L13A)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA U2824
	References : - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U34 CGTCCATGATGTTCCGCAACTACCTACATTGTTTGATCCTCATGAAAGCAGCACTGGCTGAGACGC
snoRNABase - http://www-snorna.biotoul.fr/