U35B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD35B small nucleolar RNA, C/D box 35B
	snoid : SR0000268
	Length : 88
	Abstract : Homo sapiens C/D box snoRNA U35B. This snoRNA is a close paralogue of U35A described by Nicoloso et al. (1996). It is predicted to guide the 2'O-ribose methylation of 28S rRNA C4506.
	GenBank accession number :
	Host gene : RPS11 (ribosomal protein S11)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA C4506
	sno/scaRNAs with same target 28S rRNA C4506 : U35A
	References : - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U35B TGGCAGATGATGTTTGTTTTCACGATGGTCTTCAGATGCCCACGTGGGCACTGCTGAGAAAGCCACTTGGTAAAACTGATGCCGGAAA
snoRNABase - http://www-snorna.biotoul.fr/