U38B
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD38B small nucleolar RNA, C/D box 38B
	snoid : SR0000016
	Length : 69
	Abstract : Homo sapiens C/D box snoRNA U38B. This snoRNA was initially characterized by a bioinformatics search for C/D motives in a vertebrate intron database (Nicoloso et al. 1996). It is predicted to guide the 2'O-ribose methylation of 28S rRNA A1858. U38B shares the same host gene with a closely related copy, U38A, and the C/D box snoRNAs U40 and U55 (RPS8).
	GenBank accession number : X97583
	Host gene : RPS8 (ribosomal protein S8)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA A1858
	sno/scaRNAs with same target 28S rRNA A1858 : U38A
	References : - Nicoloso, M., Qu, L. H., Michot, B., and Bachellerie, J. P. (1996). Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs. J Mol Biol, 260, 178-195.
	Sequence : >U38B TCTCAGTGATGAAAACTTTGTCCAGTTCTGCTACTGACAGTAAGTGAAGATAAAGTGTGTCTGAGGAGA
snoRNABase - http://www-snorna.biotoul.fr/