U45C
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD45C small nucleolar RNA, C/D box 45C
	snoid : SR0000017
	Length : 78
	Abstract : Homo sapiens C/D box snoRNA U45C. This snoRNA is a closely related copy of the C/D box snoRNA U45A cloned from HeLa cells by Kiss-Laszlo et al. (1996). It is predicted to guide the 2'O-ribose methylation of 18S rRNA A159. Compared to U45A, a 2 nt deletion upstream of the D' box prevents the guiding function for the methylation of 18S rRNA U172. U45C, U45A and a third paralogue,U45B, share the same host gene (RABGGTB).
	GenBank accession number :
	Host gene : RABGGTB (Rab geranylgeranyltransferase beta subunit)
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 18S rRNA A159
	sno/scaRNAs with same target 18S rRNA A159 : U45A
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088.
	Sequence : >U45C GGTCAATGATGAGTTGGCATGTATTCTGAATCTAAAGTTGATTATTACTACTTTAGCTCTAGAATTACTCTGAGACCT
snoRNABase - http://www-snorna.biotoul.fr/