U48
	HUGO Gene Nomenclature Committee HGNC Approved Symbol HGNC Approved Name SNORD48 small nucleolar RNA, C/D box 48
	snoid : SR0000335
	Length : 64
	Abstract : Homo sapiens C/D box snoRNA U48. This snoRNA was cloned by Kiss-Laszlo et al. (1996), and predicted to guide the 2'O-ribose methylation of 28S rRNA C2279, although the methylation site was not mapped by Maden (1990). U48 and the C/D box snoRNA U52 share the same host gene (C6orf48). Note that the genomic sequence differs from the published sequence (X96648) by 1nt.
	GenBank accession number : X96648
	Host gene : C6orf48
	Click here to see the position on the UCSC Genome Browser
	Target RNA : 28S rRNA C2279
	References : - Kiss-Laszlo, Z., Henry, Y., Bachellerie, J. P., Caizergues-Ferrer, M., and Kiss, T. (1996). Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell, 85, 1077-1088. - Maden, B. E. (1990). The numerous modified nucleotides in eukaryotic ribosomal RNA. Prog Nucleic Acid Res Mol Biol, 39, 241-303.
	Sequence : >U48 AGTGATGATGACCCCAGGTAACTCTTGAGTGTGTCGCTGATGCCATCACCGCAGCGCTCTGACC
snoRNABase - http://www-snorna.biotoul.fr/